View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_22 (Length: 236)
Name: NF17765_low_22
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 2112339 - 2112548
Alignment:
| Q |
18 |
gtctttatatctaagaatctagcttaagatcacatgcttggagtcactgattatggattcattttctttttgaaatgattttgcaactggctcttcacgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2112339 |
gtctttatatctaagaatctagcttaagatcacatgcttggagtcactgattatggattcattttctttttgaaatgattttgcaactggctcttcacat |
2112438 |
T |
|
| Q |
118 |
agactttcgaatgtataattaaattacnnnnnnngaaactaaactaactgtttattt-caaat-----aaggcatagataacattgaatgaaacggttgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2112439 |
agactttcgaatgtataattaaattactttttttgaaactaaaccaactgtttattttcaaatgtatgaaggcatagataacattgaatgaaacggttgt |
2112538 |
T |
|
| Q |
212 |
tccacctttg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
2112539 |
tccacctttg |
2112548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University