View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_25 (Length: 214)
Name: NF17765_low_25
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 25091251 - 25091067
Alignment:
| Q |
16 |
catttttcatcacaacctgtacataaaacattatgcaatggtgtaagtttaacaaacttcatatgattttgcatgattgacatgataaaaaatgcaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25091251 |
catttttcatcacaacctgtacataa--cattatgcaatggtataagtttaacaaacttcttatgattttgcatgattgacatgataaaaaatgcaaaca |
25091154 |
T |
 |
| Q |
116 |
agtaatgcacctacattgaacttgtagtgtcgaaccatagcatccacagacaatggaagcaaacatgcaaccagcaatagtataatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25091153 |
agtaatgcacctacattgaacttgtagtgtcgaaccatagcatccacagacaatggaagcaaacatgcaaccagcaatagtataatt |
25091067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 165
Target Start/End: Complemental strand, 29551597 - 29551550
Alignment:
| Q |
118 |
taatgcacctacattgaacttgtagtgtcgaaccatagcatccacaga |
165 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
29551597 |
taatgcacgtacgttgaacttgtagtggcgaaccatggcatccacaga |
29551550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University