View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17765_low_26 (Length: 212)
Name: NF17765_low_26
Description: NF17765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17765_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 39835016 - 39835205
Alignment:
| Q |
16 |
atttctactcagtttcgtgtccacttgggtcaagatattggttctacagaaaaagtatgggtcctttagtttccttgtcttaaatttttacatatcacta |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39835016 |
atttctactcagtttcgtgtcctcttgggtcaagatattggttctacagaaaaagtatgggtcctttagtttccttgtcttaaatatttacatatcacta |
39835115 |
T |
|
| Q |
116 |
cgtaccccattacatatatacactgcctctaaactaaaatt---gtcattttctatgctaatcgtccatctacttttaaacaaaaatgat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39835116 |
cgtaccccattacatatatacactgcctctaaactaaaattcaagtcatttcctatgctaatcgtccatctacttttaaacaaaaatgat |
39835205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University