View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17766_high_6 (Length: 247)
Name: NF17766_high_6
Description: NF17766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17766_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 46685364 - 46685128
Alignment:
| Q |
1 |
aaacttgatagctttggtgcat--gtttggatgagcgatgagattgataaaaagcacagtgagccagtcacaaattttccacaaaagctacactttgtag |
98 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46685364 |
aaacttgatagctttggtgcatatgtttggatgagcgatgagattgataaaaagca--gtgagccagtcacaaattttccacaaaagctacactttgtag |
46685267 |
T |
 |
| Q |
99 |
ctttgcaaaatcacggtggctcactagatttttcaatctcgttgctcatctaaacatgcatttactcccataaaatcatgtgtatattttgtttcctttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46685266 |
ctttgcaaaatcacggtggctcactagatttttcaatctcgttgctcatcttaacatgcatttactcccataaaatcatgtatatattttgtttcctttt |
46685167 |
T |
 |
| Q |
199 |
tgtgtagtttatgaccgtaaatgttgtttccttgatcct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46685166 |
tgtgtagtttatgaccgtaaatgttgtttctttgatcct |
46685128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University