View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17766_low_4 (Length: 404)
Name: NF17766_low_4
Description: NF17766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17766_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 9 - 388
Target Start/End: Complemental strand, 33223636 - 33223257
Alignment:
| Q |
9 |
gataatactctttaaatgcaatatcaaacccttctttctccaacactttgtctttccaattctgaaactcaaccaaagtttgataagccggctcgccgtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223636 |
gataatactctttaaatgcaatatcaaacccttctttctccaacactttgtctttccaattctgaaactcaaccaaagtttgataagccggctcgccgtg |
33223537 |
T |
|
| Q |
109 |
accaagaagtttaatgctatatcctttgcttagaataatccatccttgtggatcacgtctgaggcaaaacaagtctttcactattttttgaatctcgcaa |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
33223536 |
accaagaagtttaatgctatgtcctttgcttagaataatccatccttgtggatcacgtctgaggcaaaacaagtctttcactatttcttgaatcttgcaa |
33223437 |
T |
|
| Q |
209 |
tccacagtctcttgatgcttcttgttttgtttctttctttctatacccatccagaaacttggaacacggttaggatcatctttgcccacttgataattct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223436 |
tccacagtctcttgatgcttcttgttttgtttctttctttctatacccatccagaaacttggaacacggttaggatcatctttgcccacttgataattct |
33223337 |
T |
|
| Q |
309 |
ctattataacgtctgcacgcttgatagtctcgtgcctcttgatcttttccaactcaagtgtgaaatcttggatccatttt |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223336 |
ctattataacgtctgcacgcttgatagtctcgtgcctcttgatcttttccaactcaagtgtgaaatcttggatccatttt |
33223257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University