View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17767_high_5 (Length: 288)
Name: NF17767_high_5
Description: NF17767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17767_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 159
Target Start/End: Original strand, 31927337 - 31927453
Alignment:
| Q |
40 |
gtatttgcttgaaggtgatacttaagaccaatgaaggacaacttaccagtgaaacatggcttgaaatacttaagatcaatgaagcacgtgataatatgat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
31927337 |
gtatttgcttgaaggtgatacttaagaccaatgaaggacaacttaccagtggaacatgacttgaaatacttaagatcaatgaagcac---atgatatgat |
31927433 |
T |
 |
| Q |
140 |
accgacatgagacatgacac |
159 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
31927434 |
accaacatgagacatgacac |
31927453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 163 - 271
Target Start/End: Original strand, 31927551 - 31927659
Alignment:
| Q |
163 |
attattaaccttatgaaagcaaagttatgggaatgataatgatccttttgaaaaagaataatgagagaannnnnnnacaatacaatccttacataaataa |
262 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
31927551 |
attattaaccttatgaatgcaaagttatgggaatgataatgatccttttgaaaaagaataatgagagaaattttttacaatgcaatcgttacataaataa |
31927650 |
T |
 |
| Q |
263 |
tgcgatgat |
271 |
Q |
| |
|
||| ||||| |
|
|
| T |
31927651 |
tgctatgat |
31927659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University