View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17767_low_11 (Length: 248)
Name: NF17767_low_11
Description: NF17767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17767_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 41 - 238
Target Start/End: Original strand, 28305921 - 28306118
Alignment:
| Q |
41 |
gtacaaacacaagacgccgttatattatataatgtaatatgtggattagtgagtctagaatgttgcaaacatgattaatgtagggtttttaggtagtcta |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28305921 |
gtacaaacacaagacgccgttatattatataatgtaatatgtggattagtgagtctagaatgttgcaaacatgattaatgtagggtttttaggtagtcta |
28306020 |
T |
 |
| Q |
141 |
agtctaaatattagatttaaagattttctcaacttgctcatcaatcaaacaaatttttacttatccttataacatcggtttattgcttttatcctttg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28306021 |
agtctaaatattagatttaaagattttctcaacttgctcatcaatcaaacaaatttttacttatccttatagcatcggtttattgcttttatcctttg |
28306118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University