View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17768_high_8 (Length: 261)
Name: NF17768_high_8
Description: NF17768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17768_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 245
Target Start/End: Complemental strand, 34040359 - 34040125
Alignment:
| Q |
11 |
taatactagccattgatctaaagttgtatatggaagttagagtaaaattcactctcctagctgctagtgtgcaaggcaatgtctggtggagaattttgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| |
|
|
| T |
34040359 |
taatactagccattgatctaaagttgtatatggaagttagagtaaaattcactctcctagctgctagtctgcaaggcaatgtcttgtggagaatttggat |
34040260 |
T |
 |
| Q |
111 |
tttatgatacaaagtattaaatgttgagcatgttgcatgaaatataagttcttgcaaaaattatttttgcatgaaacagtcnnnnnnntaatgctttaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34040259 |
tttatgatacaaagtattaaatgttgagcatgttgcatgaaatataagttcttgcaaaaattatttttgcatgaaacagtcaaaaaaataatgctttaga |
34040160 |
T |
 |
| Q |
211 |
gtaacccctctttttgctcttgaagagtttggggt |
245 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34040159 |
gtaacccctctttttcctcttgaagagtttggggt |
34040125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University