View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17768_low_7 (Length: 324)
Name: NF17768_low_7
Description: NF17768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17768_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 148 - 314
Target Start/End: Original strand, 39083991 - 39084157
Alignment:
| Q |
148 |
tctgaattctaacattgagtggatgattcccactgcaatggaagaatcaatttccacaactaattatgctacatcagcatcatccactggggaatgattt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
39083991 |
tctgaattctaacattgagtggatgattcccactgcaatggaagaatcaatttccacaactaattatgctacatcagcatcatccactcgggattgattt |
39084090 |
T |
 |
| Q |
248 |
gattttgttagggctgtgaaagctactaaacagaaaaatggaaaagctggagattggttggcctttg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084091 |
gattttgttagggctgtgaaagctactaaacagaaaaatggaaaagctggagattggttggcctttg |
39084157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 39083835 - 39083870
Alignment:
| Q |
1 |
tactatgacatttgaattgtgtgtagcgtgatagct |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39083835 |
tactatgacatttgaattgtgtgtagcgtgatagct |
39083870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University