View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17769_low_10 (Length: 211)
Name: NF17769_low_10
Description: NF17769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17769_low_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 11 - 211
Target Start/End: Original strand, 45279293 - 45279495
Alignment:
| Q |
11 |
cacagaatgcacttcttaacaaccggtcacaatgtaacatgtacatatttttcaactataatatcatcatagcttcacacctctaaagtcaca--cacaa |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45279293 |
cacagactgcacttcttaacaaccggtcacaatgtaacatgtacatatttttcaactatactatcatcatagcttcacacctctaaagtcacacacacaa |
45279392 |
T |
|
| Q |
109 |
attgaattaatgaataataaagctatgacctatattcattagaatcaataatcttccaccttaacagcttcacgaggcatttcataggcatctttaggcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45279393 |
attgaattaatgaataataaagctatgacctatattcattagaatcaataatcttccaccttaacagcttcacgaggcatttcataggcatctttaggcc |
45279492 |
T |
|
| Q |
209 |
ttg |
211 |
Q |
| |
|
||| |
|
|
| T |
45279493 |
ttg |
45279495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University