View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17771_high_14 (Length: 227)
Name: NF17771_high_14
Description: NF17771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17771_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 48713469 - 48713679
Alignment:
| Q |
1 |
gcataaggcaacacttccaccacagctttgaagacatcaatgcagaagccagtggctagtgttgaattagtactatgatcacacgttatatgcaaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48713469 |
gcataaggcaacacttccaccacagctttgaagacatcaatgcagaagccagtggctagtgttgaattagtactatgatcacgcgttatatgcaaaaatt |
48713568 |
T |
 |
| Q |
101 |
cagtgtagttaaatccatttttaactggaactcctatcttcaacttcttaccaatagtaggaatttcccatccctttggaatagagttcatatcccctgg |
200 |
Q |
| |
|
||||||||||| ||||||||| || ||||| ||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48713569 |
cagtgtagttatctccatttttcaccggaacccctattctcaatttcttcccaatagtaggaatttcccatccctttggaatagagttcatatcccctgg |
48713668 |
T |
 |
| Q |
201 |
ccacatgatta |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
48713669 |
ccacatgatta |
48713679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 48701363 - 48701572
Alignment:
| Q |
1 |
gcataaggcaacacttccaccacagctttgaagacatcaatgcagaagccagtggctagtgttgaattagtactatgatcacacgttatatgcaaaaatt |
100 |
Q |
| |
|
||||||||||| || || | |||||||||||||| |||||||| ||||||||||||| |||||||||| |||||| ||||| | |||| | ||| |||| |
|
|
| T |
48701363 |
gcataaggcaaaacatctagcacagctttgaagatatcaatgctgaagccagtggcttgtgttgaattggtactaggatcatatgttactttcaagaatt |
48701462 |
T |
 |
| Q |
101 |
cagtgtagttaaatccatttttaactggaactcctatcttcaacttcttaccaatagtaggaatttcccatccctttggaatagagttcatatcccctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
48701463 |
cagtgtagttaaatccatttttaactggaactcctatcctcaacttcttaccaatggtaggaatttccgatccctttggaatagagtacatatcccctgg |
48701562 |
T |
 |
| Q |
201 |
ccacatgatt |
210 |
Q |
| |
|
||| |||||| |
|
|
| T |
48701563 |
ccatatgatt |
48701572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University