View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17771_low_18 (Length: 245)
Name: NF17771_low_18
Description: NF17771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17771_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 32410528 - 32410321
Alignment:
| Q |
19 |
gttgcatggtagaacaggtagaaaatgaatgacgcaggacaaaggatgctctgcagctacaattgaggatgccccccttttgagtcttaaattacagaac |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32410528 |
gttgcatggtagaacaggtacaaaatgaatgacgcaggacaaaggatgctctgcagctacaattgaggatgccccctttttgagtcttaaattacagaac |
32410429 |
T |
|
| Q |
119 |
ccttatatatatgaaatttaatgatataacttgttgattgacataaaatcatgagggaaaaagattcttatttattaggtcaaatttgatttgtacagtt |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32410428 |
ccttatat----gaaatttaatgatataacttgttgattgacataaaatcatgagggaaaaagattcttatttattaggtcaaatttgatttgtacagtt |
32410333 |
T |
|
| Q |
219 |
tttattcctttg |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32410332 |
tttattcctttg |
32410321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University