View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17771_low_22 (Length: 219)
Name: NF17771_low_22
Description: NF17771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17771_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 11048221 - 11048013
Alignment:
| Q |
18 |
attaattgattgcatatcaaaattcctaacctacaaaatacaaaggcaataacgagcttcctcttgatttgaatttcaggtgttcacact---------- |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11048221 |
attaattgattgcatatcaaaatttctaacctacaaaatacaaaggcaataacaagcttcctcttgatttgaatttcaggtgttcacactcataagtaat |
11048122 |
T |
|
| Q |
108 |
------aaatttataaggtcatttgtgggagaagaagtgtctagctggaagcgtgtatgagtgtgttcaatgaatttggtttgcaacattaaattatgtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11048121 |
tgaactaaatttataaggtcatttgtgggagaagaagtgtctagctggaagcgtgtatgagtgtgttcaatgaatttggtttgcaagattaaattatgtg |
11048022 |
T |
|
| Q |
202 |
tgatgatgt |
210 |
Q |
| |
|
|||| |||| |
|
|
| T |
11048021 |
tgattatgt |
11048013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 99
Target Start/End: Original strand, 10565949 - 10566012
Alignment:
| Q |
36 |
aaaattcctaacctacaaaatacaaaggcaataacgagcttcctcttgatttgaatttcaggtg |
99 |
Q |
| |
|
||||||||||| ||||||||||||| || ||||| | ||| ||||||||||||||||||||| |
|
|
| T |
10565949 |
aaaattcctaaactacaaaatacaatggtaataatggatttcttcttgatttgaatttcaggtg |
10566012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University