View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17772_high_1 (Length: 373)
Name: NF17772_high_1
Description: NF17772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17772_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 9e-92; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 44641167 - 44640955
Alignment:
| Q |
19 |
ctgtgggtgggtcaataaaaagcaacttgaaaaacaacaactcggtgatttatttgtcgttttgtcnnnnnnnnt---catggattacattggatagagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
44641167 |
ctgtgggtgggtcaataaaaagcaacttgaaaaacaacaactcggtgatttatttgtcgttttgtcaaaaaaaataatcatggattacattggatagagt |
44641068 |
T |
 |
| Q |
116 |
agtggattacccctcaagaaaaggaatggaattaaattgattaacaacttactcaacacgggagggattccaaacaaatactatgggcctcttcagcttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641067 |
agtggattacccctcaagaaaaggaatggaattaaattgattaacaacttactcgacacgggagggattccaaacaaatactatgggcctcttcagcttt |
44640968 |
T |
 |
| Q |
216 |
aaattatacaaat |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44640967 |
aaattatacaaat |
44640955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 283 - 355
Target Start/End: Complemental strand, 44640901 - 44640829
Alignment:
| Q |
283 |
gtcaaattgattactagctagaaattcaatcttaaattgaataattgagaaatttaaagttcaaactctaact |
355 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
44640901 |
gtcaaattgattactagctagaaattcagtcttaaattgaataattgagaaatttgaagtttaaactccaact |
44640829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 44680397 - 44680331
Alignment:
| Q |
19 |
ctgtgggtgggtcaataaaaagcaacttgaaaaacaacaa-ctcggtgatttatttgtcgttttgtc |
84 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
44680397 |
ctgtgggtgggccaataataagcgacttgaaaaacaacaacctcggtgattaatttgtcgttttgtc |
44680331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 94 - 150
Target Start/End: Complemental strand, 44651538 - 44651479
Alignment:
| Q |
94 |
catggattacattggata-gagtagtggatt--acccctcaagaaaaggaatggaattaa |
150 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
44651538 |
catggattacattggataagactagtggattttacccctcaagaaatggaatgaaattaa |
44651479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University