View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17772_low_4 (Length: 251)
Name: NF17772_low_4
Description: NF17772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17772_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 26 - 235
Target Start/End: Complemental strand, 51419011 - 51418795
Alignment:
| Q |
26 |
ttgttgttgttgataacagaaaagtacgaaaatacattgcattgcagaccattaataataacgcatctacaa----ctacagtctacaggtaaggtaatc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51419011 |
ttgttgttgttgataacagaaaagtacgaaaatacattgcattgcagaccattaataataacgcatctacaaacaactacagtctacaggtaaggtaatc |
51418912 |
T |
|
| Q |
122 |
aacaacat---caggagctgcagaaatagagttgtttgtttgttatttgagcttcaatatgattcacctgccacatgcatgcacatgatgttttacctgc |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51418911 |
aacaacattaacaggagctgcagaaatagagttgtttgtttgttatttgagcttcaatatgattcacctgccacatgcatgcacatgatgttttacctac |
51418812 |
T |
|
| Q |
219 |
tgggtcaaacacaacac |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
51418811 |
tgggtcaaacacaacac |
51418795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University