View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17774_high_6 (Length: 207)
Name: NF17774_high_6
Description: NF17774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17774_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 12 - 191
Target Start/End: Original strand, 36576354 - 36576533
Alignment:
| Q |
12 |
gcagtaatcccatgtcacctgttatcaaaataaagtaatactatgtcacccctcaactcagtgatgattagccttgtgttcacccatacccacaatgcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
36576354 |
gcagtaatcccatgtcacctgttatcaaaatagagtaatactatgtcacccctcaactcagtgataattagccttgtgttcacccatactcaaaatgcat |
36576453 |
T |
|
| Q |
112 |
ttattgttaagattttcaacgaatttgatgatatctctagatagttgcattttacagtatccgaatcagaagtgctttat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
36576454 |
ttattgttaagattttcaacgaatttgatgatatctctagatagttgcattttatagtatccaaatcagaagtgctttat |
36576533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University