View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17774_low_5 (Length: 337)

Name: NF17774_low_5
Description: NF17774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17774_low_5
NF17774_low_5
[»] chr7 (1 HSPs)
chr7 (11-291)||(42091831-42092111)
[»] chr8 (1 HSPs)
chr8 (106-165)||(7246546-7246605)
[»] chr4 (1 HSPs)
chr4 (108-165)||(52052018-52052075)
[»] chr2 (1 HSPs)
chr2 (108-161)||(18199801-18199854)
[»] scaffold0001 (1 HSPs)
scaffold0001 (108-164)||(399133-399189)


Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 291
Target Start/End: Complemental strand, 42092111 - 42091831
Alignment:
11 caaagggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaaggcaaagcagagaaagatccactgccattactagttggtgtgggaagttc 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||    
42092111 caaaaggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaagacaaagcagagaaagatccaccgccattactagttggtgtgggaagttc 42092012  T
111 cacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttttgtccagccaccacatccctcgcacaccgccactttttaccgtct 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42092011 cacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttttgtccagccaccacatccctcgcacaccgccactttttaccgtct 42091912  T
211 gttctccggcaacgacctggctctggatccattgctcctcttccccaatacccactttgcaacactaataaaacacaaaac 291  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42091911 gttctccggcaacgacctggctctggatccattgctcctcttccccaatacccactttgcaacactaataaaacacaaaac 42091831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 106 - 165
Target Start/End: Original strand, 7246546 - 7246605
Alignment:
106 agttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt 165  Q
    |||||||||||||||||||||||||||||||| |  ||||||||||||||||||||||||    
7246546 agttccacaggctttcttgaacggtttctacctctgtgcatgtgtctttcacagtacttt 7246605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 165
Target Start/End: Complemental strand, 52052075 - 52052018
Alignment:
108 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt 165  Q
    ||||||||||||||||||||||||| | || | ||||||||| |||||||||||||||    
52052075 ttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtacttt 52052018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 18199801 - 18199854
Alignment:
108 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagta 161  Q
    ||||||||||||||||||||||||| | || | |||||||||||||||||||||    
18199801 ttccacaggctttcttgaacggttttttcctctatgcatgtgtctttcacagta 18199854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 399189 - 399133
Alignment:
108 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtactt 164  Q
    |||||||||||||||||||||||| |  ||||| |||||||| |  |||||||||||    
399189 ttccacaggctttcttgaacggttgcggccacggtgcatgtggcgctcacagtactt 399133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University