View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_high_11 (Length: 331)
Name: NF17775_high_11
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 47620293 - 47620614
Alignment:
| Q |
1 |
aatttaaattctacaatctattcttctattctatgttgtggctacctaaattcggaaggtgatgctacatttggggtcataaaatcttgttcaaattgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47620293 |
aatttaaattctacaatctattcttctattctatgttgtggctacctaaattcggaaggtgatgctacatttggggttataaaatcttgttcaaattgta |
47620392 |
T |
 |
| Q |
101 |
gagtatgctttggatgaaccgtattttctaagataaacagtgcccaaaaatatttatatccttcatgtgtcgttggcgcatatatttgtctcaaacttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47620393 |
gagtatgctttggatgaaccgtattttctaagataaacagtgcctaaaaatatctatatccttcatgtgtcgttggcacatatatttgtctcaaacttta |
47620492 |
T |
 |
| Q |
201 |
tatcatttcagttttgctgctctgtaacacaacaacataatttcatttcatcacaatgcctcactctcattcaccaatagggctggtaattaaggcttaa |
300 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47620493 |
tatcatttcggttttactgctctgtaacacaacaacataatttcatttcatcacaatgcctcactctcattcaccaatagggctggtaattaagccttaa |
47620592 |
T |
 |
| Q |
301 |
ggactaggtttagaagtataat |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47620593 |
ggactaggtttagaagtataat |
47620614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University