View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_high_14 (Length: 320)
Name: NF17775_high_14
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 17 - 306
Target Start/End: Complemental strand, 41598350 - 41598060
Alignment:
| Q |
17 |
ctgtgaattcgcttctctaatgctgttgcatgaaaagcatgtcttgtcattgcacaggttggttgagtctccgcacttcctttgtggtggttcaatggaa |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41598350 |
ctgtgaatttgcttctctaatgctgttgcatgaaaagcatgtcttgtcattgcacaggttggttgagtctccgcacttcctttgtggtggttcaatggaa |
41598251 |
T |
 |
| Q |
117 |
tttgcagtctcacctagtgttcaaatgtcataattcataaatactgtt-tgaatatacgtagtaatgatcttgcctgtgcctaatattattttttgataa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41598250 |
tttgcagtctcacctagtgttcaaatgtcataattcataaatactgttgtgaatatacgtagtaatgatcttgcctgtgcctaatattattttttgataa |
41598151 |
T |
 |
| Q |
216 |
cagcctatgctttttaatctgtctgtttgcatatgttaattattatttgagattattacaagaatcatctgctaacctggtgaccatattg |
306 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41598150 |
cagcctatgctttataatctgtctgtttgcatatgttaattattatttgagattattacaagaatcatctgctaacctggtgaccatattg |
41598060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University