View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_high_26 (Length: 214)
Name: NF17775_high_26
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 25032032 - 25031889
Alignment:
| Q |
20 |
gggttaatgcaaacaatacatggtggctattgggtatgttgaagggtgaagaggagaggtagatttaccagagagggatgggactggaaccaatcagtac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032032 |
gggttaatgcaaacaatacatggtggctattgggtatgttgaagggtgaagaggagaggtagatttaccagagagggatgggactggaaccaatcagtac |
25031933 |
T |
 |
| Q |
120 |
gtatttttggagggaagtgataatgtgataaccatgccaacata |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031932 |
gtatttttggagggaagtgataatgtgataaccatgccaacata |
25031889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 25027357 - 25027316
Alignment:
| Q |
155 |
gccaacatattgagagttttgaacattttgggaattcagaat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25027357 |
gccaacatattgagagttttgaacattttgggaattctgaat |
25027316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University