View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_low_20 (Length: 324)
Name: NF17775_low_20
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_low_20 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 308; Significance: 1e-173; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 43054815 - 43055138
Alignment:
| Q |
1 |
tgacaattctttacgttatggatccagaatatgatagttgctaggtcaaatacagttgttattattattattgctgttattatttctggcgtccagacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43054815 |
tgacaattctttacgttatggatccagaatatgatagttgctaggtcaaatacagttgttattattattattactgttattatttctggcgtccagacgg |
43054914 |
T |
 |
| Q |
101 |
gcacaattggctagggatgcatatgtttagtccctagaaaattacccagtttcagttatgtttatgacttctgtataaatgtatactgctgatcatgttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43054915 |
gcacaattggctagggatgcatatgtttagtccctagaaaattacccagtttcggttatgtttatgacttctgtataaatgtatactgctgatcatgttc |
43055014 |
T |
 |
| Q |
201 |
aatgtttatgttttctgttgcaggaaaaagttgtttgtctcacttgcggcgatataggttttccagaggtccgggttttttgcaacaattgcaaggattg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43055015 |
aatgtttatgttttctgttgcaggaaaaagttgtttgtctcacttgcggcgatataggttttccagaggtcagggttttttgcaacaattgcaaggattg |
43055114 |
T |
 |
| Q |
301 |
tgctcttcacaggtgcttatactt |
324 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
43055115 |
tgctcttcataggtgcttatactt |
43055138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 314
Target Start/End: Complemental strand, 43186084 - 43186018
Alignment:
| Q |
249 |
gcgatataggttttccagaggtccg-ggttttttgcaacaattgcaaggattgtgctcttcacaggt |
314 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
43186084 |
gcgatgtaggttttccagaggttagaggttttttgcaacaagtgccaggcttgtgctcttcacaggt |
43186018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 320
Target Start/End: Original strand, 44804432 - 44804520
Alignment:
| Q |
232 |
tgtttgtctcacttgcggcgatataggttttccagaggtccgggttttttgcaacaattgcaaggattgtgctcttcacaggtgcttat |
320 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |||||||||| | | || ||| ||||||||||||||||| ||||| |
|
|
| T |
44804432 |
tgtttgtctcacttgcggtgatgtaggttttccagaggcgatagttttttgcaccgagtgtcaggcttgtgctcttcacaggtacttat |
44804520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University