View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_low_28 (Length: 279)
Name: NF17775_low_28
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 11 - 261
Target Start/End: Complemental strand, 36464551 - 36464299
Alignment:
| Q |
11 |
cacagacaatcattaaagcggggtacaatatttcgacaaattttaacatataaatttagccaacaaaaaatgagaattgaacatgtcatctttagcatta |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36464551 |
cacaaacaatcattaaagcggggtacaatatttcgacaaattttaacatataaatttaaccaacaaaaaatgagaattaaacatgtcatctttagcatta |
36464452 |
T |
|
| Q |
111 |
tttaactaacttgagctttaaacatattttgtcactgaactttaagcagagcttagataacattgtta-----------tttgcttccaacaattttgaa |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36464451 |
tttaactaacttgagct---------ttttgtcactgaactttaagcagagcttagataacattgttattatgtatgtgtttgcttccaacaattttgaa |
36464361 |
T |
|
| Q |
200 |
gaagaggcnnnnnnncttttcttcaggagactttgatttctaaacaaaacattcatgtaatg |
261 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464360 |
gaagaggctttttttcttttcttcaggagactttgatttctaaacaaaacattcatgtaatg |
36464299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 122 - 172
Target Start/End: Complemental strand, 14703704 - 14703654
Alignment:
| Q |
122 |
tgagctttaaacatattttgtcactgaactttaagcagagcttagataaca |
172 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
14703704 |
tgagctttaagcatattttgtcactaagctttaagcagagcttggataaca |
14703654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University