View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_low_30 (Length: 270)
Name: NF17775_low_30
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 33 - 253
Target Start/End: Original strand, 9588644 - 9588865
Alignment:
| Q |
33 |
gaatgcatgcaagaacaaatccctgtaaacaagtaaacggttttcatgcaaactgatttacnnnnnnntacaacaatgaagatgtcttcaaagtgcaatg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9588644 |
gaatgcatgcaagaacaaatccctgtaaacaagtaaacggttttcatgcaaactgatttacaaaaaaatacaacaatgaagatgtcttcaaagtgcaatg |
9588743 |
T |
|
| Q |
133 |
agtccaaaattgtcttttctgtatgtttggacatgagataacctcacaaagtccaaccacctaaattctaatatgtttgtgttgcaaaactaacgga-tt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
9588744 |
agtccaaaattgtcttttctgtatgtttggacatgagataacctcacaaagtccaaccacctaaattctaatatgttagtgttgcaaaactaacggattt |
9588843 |
T |
|
| Q |
232 |
ttttaatactgctttaaaatat |
253 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9588844 |
ttttaatactgctttaaaatat |
9588865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University