View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17775_low_36 (Length: 219)
Name: NF17775_low_36
Description: NF17775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17775_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 13367871 - 13367665
Alignment:
| Q |
1 |
tcttcaccatatcatcctatgatagcacaacatggtgcaccgagagtagtgttactttgtccacctgggtcaccatgggagacacaaccttatgaagagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13367871 |
tcttcaccatatcatcctatgatagcacaacatggtgcaccaagagtagtgttactttgtccacctgggtcaccatgggagacacaaccttatgaagagg |
13367772 |
T |
|
| Q |
101 |
gtcctaatgaggttcattttgatccagccacatccagaaataatggagcttccatgcaagtagacaataatattattgatggtgatgttgatcttaattt |
200 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13367771 |
gtcctaatgaggttcattttgatgcagctacatccagaaataatggggcttccatgcaagtagacaataatattattgatggtgatgttgatcttaattt |
13367672 |
T |
|
| Q |
201 |
gagccta |
207 |
Q |
| |
|
||||||| |
|
|
| T |
13367671 |
gagccta |
13367665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University