View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17776_high_2 (Length: 202)
Name: NF17776_high_2
Description: NF17776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17776_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 186
Target Start/End: Complemental strand, 8757897 - 8757718
Alignment:
| Q |
7 |
gagcagaacctgtgctggaatctgaaccatttgttctccaaaatatacaagctgaatcaagtgttttgccccacctgcactgataattgccttggagtga |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8757897 |
gagcagaaccaatgctggaatctgaaccatttgttctccaaaatatacaagctgaatcaagtgttttgccccacctgcactgataattgcgttggagtga |
8757798 |
T |
 |
| Q |
107 |
tcaacatgaaggtagttttcactaccagcgaatttcctaagcgcgattgacgcctcccttgaaacctctgcctctctttc |
186 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757797 |
tcaacatgaaggtagttttcactgccggcgaatttcctaagcgcgattgacgcctcccttgaaacctctgcctctctttc |
8757718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University