View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17776_low_3 (Length: 320)
Name: NF17776_low_3
Description: NF17776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17776_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 101 - 304
Target Start/End: Original strand, 954268 - 954459
Alignment:
| Q |
101 |
ttcttgtttaacttttgatttccttaattggtggttacactctttaattgttgcgacataattgatggttacactctttaaacaaaaattcatgattggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
954268 |
ttcttgtttaacttttgatttccttaattggtggttacgctctttaattgttgcgacataat-----gtttttttctttg--------ttcatgattggt |
954354 |
T |
|
| Q |
201 |
tgcaaaacttttgagttcatttggcacattttgtgttagcaagaacctttgcgtgtatgtattgcatttta-tttgttgaaaacaaaaatcaagtttgta |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
954355 |
tgcaaaacttttgagttcatttggcacattttttgttagcaagaacctttgcgtgtatgtattgcattttagtttgttgaaaacaaaaatcaagtttgta |
954454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University