View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17776_low_4 (Length: 257)
Name: NF17776_low_4
Description: NF17776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17776_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 36 - 241
Target Start/End: Complemental strand, 37186751 - 37186546
Alignment:
| Q |
36 |
cataatatgaatacgatagagaaaattgtcaaaagtagttttacaaatatgatttcacattaataatcttaaacaaattgaccttaatgatactgcagat |
135 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37186751 |
cataatatgaatacgagagagaaagctgtcaaaaatagttttacaactatcatttcacattaataatcttaaacaaattgaccttaatgatactgcagat |
37186652 |
T |
 |
| Q |
136 |
tcgcagaggtggctgaggtaagaacagtgagctggttagagattaaaggtaaaataaggactcacgttctaacaccaaacacgacatacgttgtttatct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37186651 |
tcgcagaggtggctgaggtaagaacagtgagctggttagagattaaaggtaaaatgaggactcacattctaacaccaaacacgacatacgttgtttatct |
37186552 |
T |
 |
| Q |
236 |
catcac |
241 |
Q |
| |
|
|||||| |
|
|
| T |
37186551 |
catcac |
37186546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University