View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17776_low_5 (Length: 235)
Name: NF17776_low_5
Description: NF17776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17776_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 20069728 - 20069853
Alignment:
| Q |
1 |
caaattaataatgggttatctatttcccagattttacactgtatgaaccaatgaattagatgtaaaactaggcagtctccatcgatgatgaggcagaaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20069728 |
caaattaataaggggttatctatttcccagattttacactgtatgaaccaatgaattagatgtaaaactaggcagtcttcatcgatgatgaggcagaaga |
20069827 |
T |
 |
| Q |
101 |
acaaatgatcaaccctcgacgccata |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
20069828 |
acaaatgatcaaccctcgacgccata |
20069853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 126 - 219
Target Start/End: Original strand, 20069931 - 20070024
Alignment:
| Q |
126 |
acaagtaaaggtggaacttgtcgcatgtctacagcaaagtgcaaacttattcacatggtaactaacataaatacctgattatgacccaaaattc |
219 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
20069931 |
acaagtaagggtggaacttgtcggatgtctacaacaaagtgcaaacttattcacatggttactaacataaatacctaattatgacccaaaattc |
20070024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University