View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_high_27 (Length: 249)
Name: NF17777_high_27
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 131
Target Start/End: Complemental strand, 20372651 - 20372532
Alignment:
| Q |
12 |
aaaattaattaaaatcgtcttatttagtttcaagaaaaatgttgattgtttgagaaattagatgatagacattgtagtaaaccatttaaccttttggaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
20372651 |
aaaattaattaaaatcgtcttatttagtttcaagaaaaatgttgattgattgagaaattagatgatagacattataataaaccatttaaccttttggaac |
20372552 |
T |
 |
| Q |
112 |
acttataaataagtgaagaa |
131 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20372551 |
acttataaataagtgaagaa |
20372532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University