View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_high_32 (Length: 235)
Name: NF17777_high_32
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 20372724 - 20372945
Alignment:
| Q |
1 |
gatgttttcttgaaatttaggtacaatatcatgtgatgacttgttgttttctagttttaatgcttcctgattgacttcaattagtttcataatctttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
20372724 |
gatgttttcttgaaatttaggtacaatatcatgtgatgacttgttgttttctagttttaatgtttcctgattgacttgaattagtttcataatatttcta |
20372823 |
T |
|
| Q |
101 |
attcaaatgaaaatggtttttgctcataaaattgtacttaacaccatggcggaaggctagcttacatatgaaaagttcagtatttcattcttcatcaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
20372824 |
attcaaatgaaaatggtttttgctcataaaattgtacttaacaccatggcggaaggctagcttacatatgaaaagttctgcatttcattcttcatcaagg |
20372923 |
T |
|
| Q |
201 |
tatgttctcatgcttttaaact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20372924 |
tatgttctcatgcttttaaact |
20372945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University