View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_high_33 (Length: 228)
Name: NF17777_high_33
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_high_33 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 62 - 228
Target Start/End: Original strand, 29226753 - 29226923
Alignment:
| Q |
62 |
tatttaaatgcaacaatctg----tagcagaaaataactagctgtaatagactttctagtgatgcagaaaatgctaaaactagaatccaagtgctacatc |
157 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29226753 |
tatttaaatgcaacaatctggtcgtaggagaaaataactaactgtaatagactttctagtgatgcagaaaatgctaaaactagaatccaagtgctacatc |
29226852 |
T |
 |
| Q |
158 |
atttatgattgtaccggatttttagacactttaacactagctaataatgtatttaaaattaggaaaatgtt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29226853 |
atttatgattgtaccggatttttagacactttaacactagctaataatgtatttaaaattaggaaaatgtt |
29226923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 63
Target Start/End: Original strand, 29226156 - 29226186
Alignment:
| Q |
33 |
ctaacccattatatcagttatgctaaaacta |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29226156 |
ctaacccattatatcagttatgctaaaacta |
29226186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University