View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_low_29 (Length: 311)
Name: NF17777_low_29
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 38 - 292
Target Start/End: Original strand, 21079336 - 21079591
Alignment:
| Q |
38 |
tccgtggttttggtaac--ggacactagaattgccttaaaaaattattatttgtctcataggcttgtgattannnnnnnggctaaaacgatgattagttt |
135 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21079336 |
tccgtggttttggtaactcggacactagaattgccttaaaaaat-attatttgtctcataggcttgtgattatttttttggctaaaacgatgattagttt |
21079434 |
T |
|
| Q |
136 |
ttgcaagttccttcatggtgttggcatatgcgttgctggtcccggttttacttcgcaatcagtggcacaatgcacgctctcttggtatttaggttatatc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21079435 |
ttgcaagttccttcatggtgttggcatatgcgtcgctggtcccggttttacttcgcaatcagtggcacaatgcacgctctcttggtatttaggttatatc |
21079534 |
T |
|
| Q |
236 |
ctctcacgttttccgtgaagctaacgcttaagctgacaggttggcttctatgggtca |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
21079535 |
ctctcacgttttccgtgaagctaacgcttatgctgacaggttggcttctaggggtca |
21079591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 163 - 292
Target Start/End: Complemental strand, 23980694 - 23980565
Alignment:
| Q |
163 |
atgcgttgctggtcccggttttacttcgcaatcagtggcacaatgcacgctctcttggtatttaggttatatcctctcacgttttccgtgaagctaacgc |
262 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||| |||||||||||||||||||| |||||| | ||||| ||||||||| ||||| ||||| |||||| |
|
|
| T |
23980694 |
atgcgtcgctggtcccggtttttcttcgccatcggtggcacaatgcacgctctcccggtattcaagttatctcctctcacattttctatgaaggtaacgc |
23980595 |
T |
|
| Q |
263 |
ttaagctgacaggttggcttctatgggtca |
292 |
Q |
| |
|
|| |||||||||||||||| ||||||||| |
|
|
| T |
23980594 |
ttgtgctgacaggttggcttttatgggtca |
23980565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 170 - 292
Target Start/End: Original strand, 17764579 - 17764701
Alignment:
| Q |
170 |
gctggtcccggttttacttcgcaatcagtggcacaatgcacgctctcttggtatttaggttatatcctctcacgttttccgtgaagctaacgcttaagct |
269 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||| |||||||||||||||| ||||| | ||||||||| | ||| |||||| |||| || | | |
|
|
| T |
17764579 |
gctggttctggttttacttcgcaactggtggcacaatgtacgctctcttggtattcaggttctttcctctcacatcttctgtgaaggtaactgttgtgtt |
17764678 |
T |
|
| Q |
270 |
gacaggttggcttctatgggtca |
292 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
17764679 |
gacaggttggctgctatgggtca |
17764701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 291
Target Start/End: Original strand, 33012419 - 33012540
Alignment:
| Q |
170 |
gctggtcccggttttacttcgcaatcagtggcacaatgcacgctctcttggtatttaggttatatcctctcacgttttccgtgaagctaacgcttaagct |
269 |
Q |
| |
|
|||||| |||||| | |||||||| | ||||||||||| ||||| |||||||| ||||||| ||||| ||| |||||||||||| ||| || ||| |
|
|
| T |
33012419 |
gctggttccggttgttcttcgcaaccggtggcacaatgtgtgctctgttggtattcaggttatttcctcgcacattttccgtgaagggaaccgttgtgct |
33012518 |
T |
|
| Q |
270 |
gacaggttggcttctatgggtc |
291 |
Q |
| |
|
|||||||||||| || |||||| |
|
|
| T |
33012519 |
gacaggttggctgctttgggtc |
33012540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University