View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_low_32 (Length: 287)
Name: NF17777_low_32
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 55458065 - 55458266
Alignment:
| Q |
17 |
caaagggacaaacaaaatgctttataaacttttgtttaaatattagactcaatgtgatgaaatttataaacgatgggagtggagataacacgttttaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55458065 |
caaagggacaaacaaaatgctttataaactttggtttaaatattagactcaatgtgatgaaatttataaacgatgggagtggagataacacgttttaaca |
55458164 |
T |
|
| Q |
117 |
tacgttataattaagttgatggtgacgaaccttgtaaaatatgtaac--tatatataaatataaatcacattattgtgaacgtgaaccaatttacaagtt |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55458165 |
tacgtta----taagttgatggtgacgaaccttgtaaaatatgtaactatatatataaatataaatcacattattgtgaacgtaaaccaatttacaagtt |
55458260 |
T |
|
| Q |
215 |
ggcatt |
220 |
Q |
| |
|
|||||| |
|
|
| T |
55458261 |
ggcatt |
55458266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University