View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_low_34 (Length: 279)
Name: NF17777_low_34
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 52810312 - 52810574
Alignment:
| Q |
1 |
cttgagatgggttaaagggtaaaactcttaccaatgagttgaaggtcaaaatattatta---attaaattcatctaatgtttggggttctttcttccatc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52810312 |
cttgagatgggttaaagggtaaaactcttaccaatgagttgaaggtcaaaatattattattaattaaattcatctaatgtttggg-ttctttcttccatc |
52810410 |
T |
 |
| Q |
98 |
ttttttagaaattaatatagcttgcttgctatatcactttgtttggttcaacttcaagttaataatgttttgttttatctcagagctagcttaccgaaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52810411 |
ttttttagaaattaatatagcttgcttgctatatcactttgtttggttcaacttcaagttaataatgttttgttttatctcagagctagcttaccgaaaa |
52810510 |
T |
 |
| Q |
198 |
tcatcactgtggagaatctttctacaacctttgatggcagatctagaacccagaacctcaaaaa |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52810511 |
tcatcactgtgcagaatctttctacaacctttgatggcagatctagaacccagaacctcaaaaa |
52810574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University