View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_low_45 (Length: 233)
Name: NF17777_low_45
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 93 - 215
Target Start/End: Original strand, 32112708 - 32112829
Alignment:
| Q |
93 |
ctgggtggtacttccaagaatcaaccctagttatatgctttttctaccaaaataaaaaaccctagttatatgcttttgtttagaaaacgtagagtgcaaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32112708 |
ctgggtggtacttccaagaatcaaccctagttatatgcctttt-taccaaaataaaaaaccctagttacatgcttttgtttagaaaacgtagagtgcaaa |
32112806 |
T |
|
| Q |
193 |
gtaaaatatacagatgagtttag |
215 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
32112807 |
gtaaaatttacagatgagtttag |
32112829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University