View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17777_low_53 (Length: 205)
Name: NF17777_low_53
Description: NF17777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17777_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 3 - 186
Target Start/End: Complemental strand, 8689713 - 8689530
Alignment:
| Q |
3 |
agaggagtagcatagggaggagtattaactttttagacataatctcccaataaaaagttgcaaatataagaggagtattccaactcttgttatccagatg |
102 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8689713 |
agaggagtattatacggaggagtattaactttttagacataatctcccaataaaaagttgcaaatataagaggagtattccaactcttgttatccagatg |
8689614 |
T |
|
| Q |
103 |
cataaggtcaaacacacacaaattaacattcggtaactctccaatattttgaggaacaagcaccgaaccatcgtcaagcgatct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8689613 |
cataaggtcaaacacacacaaattaacattcggtaactctccaatattttgaggaacaagcaccgaaccatcgtcaagcgatct |
8689530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University