View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17778_high_12 (Length: 243)
Name: NF17778_high_12
Description: NF17778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17778_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 234
Target Start/End: Original strand, 39053587 - 39053698
Alignment:
| Q |
123 |
gtttaaaatttgaagatgaagaatatgaaccgtttagtcatacgtaaatcttttgggataatggatgtacgtatgtgtagaagnnnnnnntgaatggtta |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
39053587 |
gtttaaaatttgaagatcaagaatatgaaccgtttagtcatacgtaaatcttttgggataatggatgtacgtatgtgttgaagaaaaaaatgaatggtta |
39053686 |
T |
 |
| Q |
223 |
caacagaattat |
234 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39053687 |
caacagaattat |
39053698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University