View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17779_high_8 (Length: 270)
Name: NF17779_high_8
Description: NF17779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17779_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 19 - 149
Target Start/End: Original strand, 8878733 - 8878874
Alignment:
| Q |
19 |
tttaatccctttttggactgttccactta-----------aacatcaatgacaattgcatgcagtaatgtaaaccaaattttaagcctacaaatacattg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8878733 |
tttaatccctttttggactgttccacttaccacgttatggaacatcaatgacaattgcatgcagtaatgtaaaccaaattttaagcctacaaatacattg |
8878832 |
T |
|
| Q |
108 |
gaccaaccctaatttatnnnnnnnttatgtacctctacaaac |
149 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| |
|
|
| T |
8878833 |
gaccgaccctaatttataaaaaaattatgtacctctacaaac |
8878874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 181 - 247
Target Start/End: Original strand, 8878906 - 8878972
Alignment:
| Q |
181 |
gatcataacaactatcaattcttcacacatcctcaagacataattcaagtggttgagctaaacccct |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8878906 |
gatcataacaactatcaattgttcacacatcctcaagacataattcaagtggttgagctaaacccct |
8878972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University