View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17779_high_9 (Length: 236)
Name: NF17779_high_9
Description: NF17779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17779_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 49169767 - 49169551
Alignment:
| Q |
5 |
tcttttttcatcaataaagaaatttgtatcaacaaatgtagctttttgagaatcattatgttctgttaagagttgttccaacatctatatttatcggatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49169767 |
tcttttttcatcaataaagaaatttgtatcaacaaatgtagcttgttgagaatcattatgttttgttaagagttgttccaacatctatatttatcggatc |
49169668 |
T |
 |
| Q |
105 |
acacttatcatcgtcaaagatttcggttgctatatatgtagctcatgctttttgtataattacatcaaggaataaaaatggctatatgccacgtatataa |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49169667 |
acacttatcatcgtcacagatttcggttgctatatatgtagctcatgctttttgtataattacatcaaggaataaaaatggctatatgccacgtatataa |
49169568 |
T |
 |
| Q |
205 |
gatgaggttgatgctac |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49169567 |
gatgaggttgatgctac |
49169551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 142 - 175
Target Start/End: Complemental strand, 31226637 - 31226604
Alignment:
| Q |
142 |
gtagctcatgctttttgtataattacatcaagga |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
31226637 |
gtagctcatgctttttgtataactacatcaagga |
31226604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University