View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17779_low_7 (Length: 298)
Name: NF17779_low_7
Description: NF17779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17779_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 15 - 280
Target Start/End: Complemental strand, 46046831 - 46046566
Alignment:
| Q |
15 |
aattagagtacagagatggagagttcatgctcctcccaacccacaatttggtgttgccgatgcttctcacatttgcatcatgtaggttggtaccagctga |
114 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46046831 |
aattagagtacagagatggagagttaacgctcctcccaacccacaatttggtgttgccgatgcttctcacatttgcatcatgtaggttggtaccagctga |
46046732 |
T |
|
| Q |
115 |
ccgacctagctggtattggagcacctccatctctgaaccctatatctttgttgatatatctatgtttttcgtttctcctatgtttaattatgtctttctc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46046731 |
ccgacctagctggtattggagcacctccatctctgaaccctatatctttgttgatatatctatgtttttcgtttctcctatgtttaattatgtctttctc |
46046632 |
T |
|
| Q |
215 |
tcttccctttgcctgccttaggcagtggaagagaagaatttggatggcctaaaatgttaagaatgt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46046631 |
tcttccctttgcctgccttaggcagtggaagagaagaatttggatggcctaaaatgttatgaatgt |
46046566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University