View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17779_low_8 (Length: 280)
Name: NF17779_low_8
Description: NF17779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17779_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 51033746 - 51033493
Alignment:
| Q |
16 |
cattatctcttacccagctatgtctatatataga--aacttcttgcagcattgttctttgaagcattatccttacccaaagcaagcttctgtccc-tcta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51033746 |
cattatctcttacccagctatgtctatatatatataaacttcttgcagtattgttctttgaagcattatccttacccaaagcaagcttctgtcccctcta |
51033647 |
T |
|
| Q |
113 |
tcctacccnnnnnnnnnngcttagtatactattataatatactttgcacaagagaaggcaaaaggaaaatttactaaatagttagttatggaagaagata |
212 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51033646 |
tcctacccaaaaaaaaaagcttagtatactattata---tactttgcacaagagaaggcaaaaagaaaatttactaaattgttagttatggaagaagata |
51033550 |
T |
|
| Q |
213 |
ttgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51033549 |
ttgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
51033493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 203 - 269
Target Start/End: Original strand, 40611750 - 40611816
Alignment:
| Q |
203 |
gaagaagatattgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
40611750 |
gaagaagatattgtgattgtgggagctggaattgctggcctcacaacatccttggcacttcacaggt |
40611816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 203 - 269
Target Start/End: Complemental strand, 51036967 - 51036901
Alignment:
| Q |
203 |
gaagaagatattgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| || | |||| |||||| |
|
|
| T |
51036967 |
gaagaagatattgtgattgtgggagctggaattgctggactcacaacatccttaggactttacaggt |
51036901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 207 - 269
Target Start/End: Complemental strand, 51067607 - 51067545
Alignment:
| Q |
207 |
aagatattgtgattgtgggagctggaattgctggtctcacaacatctttggcacttcacaggt |
269 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
51067607 |
aagatattgtgatcgtaggagctggaattgctggcctcacaacatccttgggacttcacaggt |
51067545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 240
Target Start/End: Complemental strand, 51070242 - 51070205
Alignment:
| Q |
203 |
gaagaagatattgtgattgtgggagctggaattgctgg |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51070242 |
gaagaagatgttgtgattgtgggagctggaattgctgg |
51070205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University