View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1777_high_29 (Length: 279)
Name: NF1777_high_29
Description: NF1777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1777_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 856006 - 856257
Alignment:
| Q |
13 |
aaaataggctagttagtttttaaaaagtgtatgttatatcattcgataccatttcactctgttttgggattttaaagtacattttgcagcatataccgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
856006 |
aaaataggctagttagtttttaaaaagtgtatgttatatcattcgataccatttcactctgttttgggattttaaagtacattttgcagcatataccgga |
856105 |
T |
|
| Q |
113 |
acaggaaacaatgctgcccgtggtgggattgctcgcacgactcaagttgcactttctgttaggctttttgcagcaaaggtgaatttatgtcctgtgattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
856106 |
acaggaaacaatgctgcccgtggtgggattgctcgcgcgactcaagttgtactttctgttaggctttttgcagcaaaggtgaatttatgtcctgtgattc |
856205 |
T |
|
| Q |
213 |
aagctgatttgtgggcaattttttggagcttgaagattgctagagaccaagg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
856206 |
aagctgatttgtgggcaattttttggagcttgaagattgctagagactaagg |
856257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University