View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1777_low_28 (Length: 299)
Name: NF1777_low_28
Description: NF1777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1777_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 49145557 - 49145769
Alignment:
| Q |
17 |
gaaacagcttgcggatgaactacgttctgatgttattttcagtgtttcaagaactgggggacatttaggttcaagtttaggtgttgttgaactaactatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49145557 |
gaaacagcttgcggatgaactacgttctgatgttattttcagtgtttcaagaactgggggacatttaggttcaagtttaggtgttgttgaactaactatt |
49145656 |
T |
|
| Q |
117 |
gctcttcactatgtttttaatacacctcaggataagattttgtgggatgttggtcaccaggttagttggtgttgttatgttgtctaagtttgttgaggat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
49145657 |
gctcttcactatgtttttaatacacctcaggataagattttgtgggatgttggtcaccaggttagttggtgttgttatgttgtctatgtttgttgaggtt |
49145756 |
T |
|
| Q |
217 |
taaattctgtttg |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49145757 |
taaattctgtttg |
49145769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 6867830 - 6867668
Alignment:
| Q |
17 |
gaaacagcttgcggatgaactacgttctgatgttattttcagtgtttcaagaactgggggacatttaggttcaagtttaggtgttgttgaactaactatt |
116 |
Q |
| |
|
|||||| |||||| ||| || ||||| ||| ||||||||||||||||| ||||||||| ||||| || |||| | |||||||| ||||| ||| || |
|
|
| T |
6867830 |
gaaacaacttgcgtgtgagctgcgttcagatattattttcagtgtttcacaaactgggggtcatttgggatcaaaccttggtgttgtggaactcactgtt |
6867731 |
T |
|
| Q |
117 |
gctcttcactatgtttttaatacacctcaggataagattttgtgggatgttggtcaccaggtt |
179 |
Q |
| |
|
|| || || |||||||| ||| | ||| || || || ||||||||||| ||||| |||||| |
|
|
| T |
6867730 |
gccctccattatgttttcaatgctcctattgacaaaatcttgtgggatgtaggtcatcaggtt |
6867668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University