View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1777_low_42 (Length: 236)
Name: NF1777_low_42
Description: NF1777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1777_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 219
Target Start/End: Complemental strand, 38748451 - 38748244
Alignment:
| Q |
12 |
caatgactctgactcagactccgacgatccttactcttctgaccattttcgcatgtatgaattcaaagtccgccgctgcactcgtagccggagccacgac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38748451 |
caatgactctgactcagactccgacgatccttactcttccgaccattttcgcatgtatgaattcaaagtccgccgctgcactcgtagccggagccacgac |
38748352 |
T |
 |
| Q |
112 |
tggactgactgtccatttgctcaccccggtgagaaagctcgccgccgtgatccacggcggtttcattactcagggacggtttgccctgagtatcgccgcg |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38748351 |
tggactgactgtccattcgctcaccccggtgagaaagctcgccgccgtgatccacggcggtttcattactcagggacagtttgccctgagtatcgccgcg |
38748252 |
T |
 |
| Q |
212 |
gtggctgt |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
38748251 |
gtggctgt |
38748244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 64 - 122
Target Start/End: Original strand, 30385537 - 30385595
Alignment:
| Q |
64 |
atgtatgaattcaaagtccgccgctgcactcgtagccggagccacgactggactgactg |
122 |
Q |
| |
|
||||| || |||||| |||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30385537 |
atgtacgagttcaaaatccggcgatgcacccgtagccggagccacgactggactgactg |
30385595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 161
Target Start/End: Complemental strand, 42926378 - 42926326
Alignment:
| Q |
109 |
gactggactgactgtccatttgctcaccccggtgagaaagctcgccgccgtga |
161 |
Q |
| |
|
|||||||| || ||||| ||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
42926378 |
gactggacggagtgtcctttttctcatcccggcgagaaagctcgccgccgtga |
42926326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University