View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1777_low_45 (Length: 228)
Name: NF1777_low_45
Description: NF1777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1777_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 35042390 - 35042190
Alignment:
| Q |
20 |
agtgccacatgatgttgatatgactattacactaacattagttttctgttcttttctgatcattttatcattcttcacgataactgaaatggctacattt |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042390 |
agtgccacatgatgttgatatcactattacactaacattcgttttctgttcttttctgatcattttatcattcttcacgataactgaaatggctacattt |
35042291 |
T |
 |
| Q |
120 |
ctttttatctgttagtaatgcatcttattatctcatccgataagtttggttatttcaatactcatctccttgcaattcctttgactattatttcatctca |
219 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
35042290 |
ctttttatctgctagtaatgcatcttattatctcatccgataagtttggttatttcaatactcgtctccttgcaattcctttcactattatttcatttca |
35042191 |
T |
 |
| Q |
220 |
c |
220 |
Q |
| |
|
| |
|
|
| T |
35042190 |
c |
35042190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University