View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17781_high_22 (Length: 220)
Name: NF17781_high_22
Description: NF17781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17781_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 37146943 - 37146755
Alignment:
| Q |
17 |
gtgttctgcttgctgcgttgtagggcgtttggttcttggtttcgttctgtgttgacggtatgtccatacgccagttttttgaactctggttagtgcttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37146943 |
gtgttctgcttgctgcgttgtagggcgtttggttcttggtttcgttctgtgtcgacggtatgtccatacgccagttttttgaactctggttagtgcttca |
37146844 |
T |
 |
| Q |
117 |
aatgttttcaaatcatctctcttttgcaatctggtttcgctcccatacgcgagtgtgttggattgtcctcatgaccgcggtttgtttgt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37146843 |
aatgttttcaaatcatctctcttttgcaatctggtttcgctcccatacgcgagtgtgttggattgtcctcatgaccgcggtttgtttgt |
37146755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 182
Target Start/End: Original strand, 25710777 - 25710821
Alignment:
| Q |
138 |
ttttgcaatctggtttcgctcccatacgcgagtgtgttggattgt |
182 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||||||||||||| |
|
|
| T |
25710777 |
ttttgcaacttggtttcgctcccgtacgcgggtgtgttggattgt |
25710821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University