View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17781_low_18 (Length: 241)
Name: NF17781_low_18
Description: NF17781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17781_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 82 - 241
Target Start/End: Original strand, 43214003 - 43214162
Alignment:
| Q |
82 |
aaagtaaatgatgaaattactctactaagccgatgacactctcagtactactacataatttagtatcttgcaataaatgaaatgtttatggcattattta |
181 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43214003 |
aaagtaaatgatcaaattactctgctaagccgatgacactctcagtactactacataatttagtatcttgcaataaatgaaatgtttatggcattattta |
43214102 |
T |
 |
| Q |
182 |
caagtagtttaataattttggttgtataactgtaaatgaaatgtaatgttgcaaataaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43214103 |
caagtagtttaataattttggttgtataactgtaaatgaaatgtaatgttgcaaataaat |
43214162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University