View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17781_low_24 (Length: 220)

Name: NF17781_low_24
Description: NF17781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17781_low_24
NF17781_low_24
[»] chr3 (1 HSPs)
chr3 (17-205)||(37146755-37146943)
[»] chr4 (1 HSPs)
chr4 (138-182)||(25710777-25710821)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 37146943 - 37146755
Alignment:
17 gtgttctgcttgctgcgttgtagggcgtttggttcttggtttcgttctgtgttgacggtatgtccatacgccagttttttgaactctggttagtgcttca 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
37146943 gtgttctgcttgctgcgttgtagggcgtttggttcttggtttcgttctgtgtcgacggtatgtccatacgccagttttttgaactctggttagtgcttca 37146844  T
117 aatgttttcaaatcatctctcttttgcaatctggtttcgctcccatacgcgagtgtgttggattgtcctcatgaccgcggtttgtttgt 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37146843 aatgttttcaaatcatctctcttttgcaatctggtttcgctcccatacgcgagtgtgttggattgtcctcatgaccgcggtttgtttgt 37146755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 182
Target Start/End: Original strand, 25710777 - 25710821
Alignment:
138 ttttgcaatctggtttcgctcccatacgcgagtgtgttggattgt 182  Q
    ||||||||  ||||||||||||| |||||| ||||||||||||||    
25710777 ttttgcaacttggtttcgctcccgtacgcgggtgtgttggattgt 25710821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University