View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17782_low_11 (Length: 247)
Name: NF17782_low_11
Description: NF17782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17782_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 39102917 - 39103149
Alignment:
| Q |
1 |
tagcttctcaaatttcacgttgcacatgctttgggacgcgagaatttggatgcagaagttgttccaaacatcctattaatcaagattaaatgttttatat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39102917 |
tagcttctcaaatttcacgttgcaaatgctctgggatgcgagaatttggatgcagaagttgttccaaacatcctattaatcaagattaaatgttttatat |
39103016 |
T |
|
| Q |
101 |
ttcaaccttgtttttaaggtttcagaaaatttaatggttattcaatcttgatcgaacaatttagacatccccaattgcatgcggtcactcaacacacaat |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39103017 |
ttcaaccttgttttttaggtttcagaaaatttaatggttattcaatcttgatcgaacaatttagacatcgccaattgcatgcggtcactcaacacacaat |
39103116 |
T |
|
| Q |
201 |
tcatgtttcatgccaaagtggacaacacatatt |
233 |
Q |
| |
|
|| | |||||||||||||||||||||||||||| |
|
|
| T |
39103117 |
tcgtatttcatgccaaagtggacaacacatatt |
39103149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 52218401 - 52218319
Alignment:
| Q |
1 |
tagcttctcaaatttcacgttgcacatgctttggga-------cgcgagaatttggatgcagaagttgttccaaacatcctat |
76 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
52218401 |
tagcttctcgaatttcacgttgcacatgctttgagagttgagacgcgagaatttggatgcgaaagttgttccaaacatgctat |
52218319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University