View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17782_low_13 (Length: 228)
Name: NF17782_low_13
Description: NF17782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17782_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 13 - 213
Target Start/End: Original strand, 35008431 - 35008616
Alignment:
| Q |
13 |
tgagatgaaaaggagaaagagagaagttagcgtgtaccagtaggttgcggttgcggttgcggttgcggttgattgtggttttcgtagccattttcagaat |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35008431 |
tgagatgaaaaggagaacgagagaagttagcgtgtaccagtaggtt------gcggttgcggttgcggttgattgtggttttcgtagccattttcagaat |
35008524 |
T |
 |
| Q |
113 |
tcatcgttttctgggaacaatttctgcgttgggtttctgttcgcttcagtggcaacaaggttatgaatgatgcaacgaacgaaagggtgcctgtagtttc |
212 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
35008525 |
tcattgttttcttggaacaatttc-----tgggtttctgttcgctacagtggcaacaaggttatgaatgatgc----aacgaaagggtgcccgtagtttc |
35008615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University